Suggestions(1)
Exact(6)
"We are definitely, I'm sure, putting a declaration of interest forward, as we've done with the Celtic nations, to ensure that ultimately we get the best football played here in Wales".
Hoff cited that New Jersey Transit has not put any interest forward and would just end up becoming another parking lot rather than a tax revenue.
In Table 1 we reported, for each gene of interest, forward (F) and reverse (R) primer sequence and their NCBI accession number, amplicon length and cycle number at the exponential phase.
Previously described primers were used for the region of interest: forward primer 5′-CAGCAGCTTTTCGGAAAATG-3′ and biotinylated reverse primer 5′-TATCCACGGGACCGCTTCTTCAC-3′ [ 18].
For these reasons, flies have long represented an ideal organism to conduct mutagenesis screens to isolate genes regulating a particular biological process of interest ("forward genetics", i.e. going from phenotype to gene).
For PCR amplification of each gene of interest, forward primers were designed to include the attB1 site (ggggacaagtttgtacaaaaaagcaggcttg and the first 20 bp of the gene, and reverse primers to include the attB2 site (ggggaccactttgtacaagaaagctgggtc) and the last 20 bp of the gene, excluding the stop codon.
Similar(54)
But what the American people understand is, is that I look at what we need to get done to keep the American people safe and to move our interests forward, and I make those decisions.
Let us now consider the more general case where the self-interference backscattering and the signal-of-interest forward scattering are not perfectly overlapped.
This app wants to help you move your business interests forward by upping your networking game.
To propel his own interests forward, Mr. Trump is now working hard to make the case to the public that a free press is an annoyance he - and we - can do without.
The PIT keeps track of interests forwarded toward the content source(s) so that returned data can be sent back to its requester(s).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com