Sentence examples for integration was confirmed from inspiring English sources

Update:  A few minutes ago the integration was confirmed by Dailymotion's VP for international Luc Dumont on Twitter.

Correct integration was confirmed genetically.

Proper integration was confirmed by PCR and western blot.

Proper integration was confirmed by using primers GAGTAGCATTACGTTTAGCCA and AAAGATCCTGGTAGCTTCAAT.

Correct integration was confirmed by unambiguous PCR analysis.

Integration was confirmed by Southern Blot analysis (data not shown).

The homologous recombination and specific integration were confirmed by genomic Southern Blot.

The presence of SALK T-DNA insertion in AtNUP62 gene and DR5::GUS integration were confirmed respectively by PCR and ß-glucuronidase activity, and homozygotes were selected at the next generation by checking the absence of AtNUP62 PCR product and the presence of GUS activity in the progeny (100%% of GUS positive plantlets).

All integrations were confirmed with Sanger sequencing.

All deletions and integrations were confirmed by PCR and southern blotting.

Integrations were confirmed at HK022 att with primers 7 and 8, and 186 att with 26 and 27.