Sentence examples for instructions forward from inspiring English sources

PWO polymerase (Roche) was used with the following oligonucleotides in PCR reactions as per manufacturers instructions: Forward, 5'-CCGGGCACTGCTGCGTTCCTGCTCAG-3'; Reverse, 5'-GTCCTGAGCAGGAACGCAGCAGTGC-3'.

NRP1 open reading frames were subcloned into the pENTR/D-TOPO vector by PCR amplification with primers designed according to the manufacturer's instructions (forward, 5′-CACCATGGAGAGGGGGCTGCC-3′; reverse, 5′-TCATGCCTCCGAATAAGTACTCTGTG-3′) using TOPO cloning (Invitrogen).

PRELI/LEA− Tg embryo tail or resorption site DNA was prepared by standard methods and amplified with an Accuprime polymerase kit (Invitrogen) according to the manufacturer's instructions; forward SR- α promoter primer 5′CGCCCAGTTCCGCCCATTCT3′ and reverse PRELI/LEA−-6X His primer 5′TGTGTCTAGATCAGTGGTGGTGGTGGTGGTGGAGCTGCCGCTGCTGCTG3′ were used for the procedures.

Following Alex's instructions to "forward paddle", "back paddle", and "stop", we negotiated rapids with such safe, cosy names as the Wall, the Washing Machine and the Storm.

He presented the letter with instructions to forward it to Humana's CEO.

Players were given the following standard instructions: "Run forward for three steps and land with one foot on the force plate", "Jump as high as possible and simulate shooting a basketball".

ICAM-3 GFP ICAM-3 GFPth a carboxy terminal EmGFP tag) was constructed using the Vivid Colours pcDNA6.2/C-EmGFP-GwithPO mammalian expression vecarboxyife terminalgiEmGFPaisley, UK) as per tag manufacturer's instructions, wash forward primer: 5′-ATTTAAGconstructedCATGGTACCA-3′ and reverse primer: 5′-TTTTGCGGCCGCTATCATTACTTGTACAGCTCG-3′.

"Today's decision is either just such a 'railway ticket'... or a broad, new-fangled concept of state standing with little instruction going forward," King wrote.

See this guide for more detailed instructions on forwarding ports.

While visiting mosques, he photographed worshipers and recorded cellphone numbers of people who attended Islamic instruction classes, forwarding all of it to his handler.

When Ms. Quinn, on video, accompanied the live dancing of Ms. Fenley by reciting movement instructions — left, right, forward, back — as if they were a ruminative soliloquy, the combination was stronger, yet the text and choreography generally slipped past each other.