Sentence examples for instructions expression from inspiring English sources

siRNA sequences for PLDs are as follows: human PLD1 (nucleotides, 1571 to 1591, AAGGUGGGACGACAAUGAGCA) and human PLD2 (nucleotides, 1378 to 1396, ACAUAAAGGUGAUGCGUCA). Following the manufacturer's instructions, expression plasmids or siRNA were transiently transfected into cells using LipofectAmine Plus (Invitrogen) or Polyfect (Qiagen) reagents.

The RNA was subjected to DNase treatment (Ambion, INC) to eliminate genomic contamination, according to the manufacturer's instructions Gene expression was analysed using the Mouse Cytokine Expression Array (R&D systems).

PNPO was expressed using the Thermo Scientific 1-Step Human Coupled IVT Kit according to manufacturer's instructions; this expression system uses a HeLa cell lysate.

Delius was unaccustomed to preparing his works for performance and tended to leave out crucial instructions about expression and dynamics.

Mutation I691F and A623V were created by site-directed mutagenesis using QuikChange Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer's instructions using expression plasmid pEGFP-N1-TSHR as a template.

Three hundred nanograms of total RNA were used for RNA amplification according to the manufacturer's instructions (WT Expression Kit; Ambion, Austin, TX, USA).

The arrays were subsequently washed and stained in a Fluidics Station (Affymetrix) and scanned by GeneScanner 3000 according the manufacturer's instructions (GeneChip Expression Analysis Technical Manual, Affymetrix).

Quantitative PCR with technical duplicates was carried out on 48.48 dynamic arrays from Fluidigm according to manufacturer instructions, and expression was normalized to GAPDH.

Washing and staining was performed by using an Affymetrix Fluidics Station 450 according to the manufacturer's instructions (GeneChip expression analysis technical manual).

qRT-PCR was performed using TaqMan® Universal PCR Master Mix, no AmpErase® UNG (Life Technologies, Burlington, ON, CA) according to the manufacturer's instructions; miRNA expression levels were normalized relative to RNU6B using the Δ Ct method, and compared to that of 16-week-old whole human fetal brain control.

Freshly isolated RNA was converted to cDNA using a PrimeScript™ RT Reagent Kit (Takara Bio Inc., Shiga, Japan), qRT-PCR was performed using SsoFast™ EvaGreen® Supermix (Bio-Rad) according to the manufacturer's instructions, and expression levels were measured as reported previously [ 25].