Sentence examples for inserts together with from inspiring English sources

Exact(4)

The medium from the upper inserts, together with non-invading cells were removed off the upper Matrigel surface.

S. cerevisiae EBY100 (Invitrogen, Carlsbad, CA, USA) was transformed with the gel-purified library inserts together with BamHI/NotI-digested pYD1 using the lithium acetate method [7].

Inserts together with a 5′-T7 promotor sequence were amplified with M13 plasmid-specific primers and transcribed into RNA by use of Megascript T7 reagents (Ambion, Austin, TX, USA).

SCC-9 and DOK cells (2 × 104 cells/insert for 24-well plate) were plated onto Matrigel-coated cell culture inserts together with either anti-EMMPRIN antibody (20 μg/mL), non-immune IgG, uPA inhibitor amiloride (20 nmol/L; Sigma) or the MMP inhibitor marimastat (10 μmol/L; British Biotechnology, Oxford, UK).

Similar(56)

The restriction site in the 3' UTR into which the IRES-CreER/TetR/FNF cassette was inserted, together with the sequence of ten nucleotides on each side of the insertion sites are as follows.

After briefly vortexing, 300 µl of solution were transferred to a small insert together with 600 µl ddH2O.

The loxP flanked neomycin resistance - thymidin kinase gene (neo-tk) selection cassette was inserted together with a 141 bp wt cDNA fragment of the β1 integrin gene coding for the entire cytoplasmic tail of the β1 integrin chain including the stop codon, into exon 15, just behind and in frame with the transmembrane coding region.

The prostheses were then inserted together with cement and compressed axially.

Furthermore, the healing of endosseous implants was not improved when those were inserted together with OCHS [ 21].

The next knotless anchor was then inserted together with the tape through the infraspinatus tendon and into the valley of the Hill-Sachs defect.

The eGFP gene was removed by SpeI/HindIII digest and a LoxP adaptor molecule with NheI (5') and XbaI (3') compatible ends (CTAGCGGGGGCGCCGGGATCGATATATAACTTCGTATAGCATACATTATACGAAGTTATTTAATTAAGGGAAGCTTGGGT) inserted together with the NheI/HindIII fragment from phrGFP-N1 (Clontech) to generate pLoxPhrGFP.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: