Sentence examples for inserts to create from inspiring English sources

The objectives of our in vitro study were to evaluate a knee wear simulation based on patient daily activities in combination with artificial ageing of polyethylene inserts to create an optimised simulation of in vivo wear modes.

"I wear three girdles, three tights, foam hip inserts and foam breast inserts to create my shape.

If you're wondering why your blanket doesn't seem as plush as the bedding on display in stores, here's the scoop: That display duvet is usually stuffed with two down feather inserts to create that fluffy, lush look.

In Furby Fill-Ins, nouns, verbs and other parts of speech can be inserted to create stories based on different situations.

Compare, for example, his Platonic all-white 3-D gridded cube skeleton from 1965 and her cube of perforated steel with hundreds of little rubber tubes inserted to create a furry, sexually suggestive interior.

Figure 9 The additional links that need to be inserted to create G 2 from G are shown in this figure.

An EPS foam block was inserted to create a hollow cross-section of the specimen so as to enhance its torsional resistance and reduce its self-weight.

The outside of the towers still have the putlog holes from their original construction, where timbers were inserted to create a spiralling ramp for the builders.

pLAY406 was digested with Bgl II and the Bam HI/Bgl II hisG-URA3-hisG universal disruptor fragment inserted to create the plasmid pLAY411.

pLAY482 was linearized in the SRS2 coding sequence by digestion with Msc I, and the 1.7 kb Pvu II TRP1 fragment from pUC-TRP inserted to create pLAY484.

The primers TTCACATTGCATGTGTGTGG and TAGCCTGCGTAGTGTTGGTG amplify a 423 bp fragment from the normal sirt1 allele while a 526 bp fragment from the null allele is amplified from the first primer and ATTTGGTAGGGACCCAAAGG, a sequence derived from the pgk-1 gene inserted to create the null allele by homologous recombination.