Sentence examples for inserts including the from inspiring English sources

Exact(4)

More recently there has been acknowledgement of the spread of non-traditional types of penile cutting, penile inserts and other practices in PNG [ 32, 35, 37- 39] Hull and Budiharsana [ 32] describe how the use of penile inserts (including the insertion of ball bearings, beads and other objects, and the injection of silicon) is spreading among men in SE Asia and Melanesia.

Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements.

So now, the 1977 classic has incongruous CGI inserts, including the infamous decision to make Han Solo shoot first in his confrontation with the alien bounty hunter Greedo.

There is a good agreement with the measured values of cf voi /cf true for the larger inserts, including the 113-ml sphere.

Similar(56)

These vaccine designs compress HIV-1 diversity to maximize the coverage of circulating strains: the proposed inserts include the most common variants of HIV-1, thereby infecting strains will be more likely to match or be genetically closer to the vaccine antigen.

Mr. Baker said that major newspapers would include it as a paid insert, including The Milwaukee Journal Sentinel, The Cleveland Plain Dealer and The Des Moines Register.

Use of the device should increase patient safety wherever nasogastric tubes are inserted including the emergency department, critical care areas, perioperatively, and in the field, among others.

The genomic region corresponding with the NP225-GAL4 includingncluding the mdg3 natural transposon (see Figure 2B), was PCR amplified from NP80-GAL4 genomic DNA (which also contains the mdg3 element in this location) using NP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTG) aNP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTGs.

The cloning junctions and entire MpXyn10A insert (including the CBM1 and catalytic domains) were sequenced and transformed [ 32] into A. nidulans strain A773 (pyrG89, wA3, pyroA1).

The promoter region of RPL18 was inserted, including the TSS, the ATG, the splicing donor site and the LTSM of the gene, in detail: - 1000 bp to +90 bp (primers RPL18_HD, RPL18_XH2 in Additional file 15).

MapSplice aligns paired-end reads using these constraints and also incorporates a maximum likelihood method operating on the splice graph to infer the alignment of the complete insert, including the unsequenced fragment, given the distribution of insert lengths (Hu et al., 2010).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: