Sentence examples for inserting part of from inspiring English sources

After a year of inserting part of the virus's DNA into target cells, the cells showed almost no signs of cancer.

A cloning intermediate, php15, was created by inserting part of the human ODC 5' UTR (accession NM_002539) amplified using primers (ODCHP F, GATTACAAAGCTTCTCGAGGGGCGAATACGAATTCGTCA and ODCHP R, GATTACAAAGCTTTTAATTAAGGATCCGTCTTCCCGCCGCC) into the HindIII site of pGL4.15cmv.

Studies in plant physiology, confirm that fructan, for example levan has a direct protective effect and capacity to stabilize membranes during drying by inserting part of the polysaccharide into the lipid headgroup region [ 20].

Crabs crack the shells with their pincers and starfish use their water vascular system to force the valves apart and then insert part of their stomach between the valves to digest the bivalve's body.

The inserted part of the catheter was about 2 cm so it could reach the lumbar enlargement of the spinal cord.

In the chaperone subunit complexes, the chaperone inserts part of a β-strand (strand G1) in the subunit's groove and thus complements in trans the incomplete fold of the pilus subunit, a process called donor-strand complementation (Choudhury et al, 1999; Sauer et al, 1999).

The inserted parts of all screws were conical with a maximum diameter of 6 mm and 40 mm long.

Therefore, the P. aeruginosa chromosome presents a picture of a mosaic, consisting of a conserved core component, interrupted in each strain by the inserted parts of the accessory genome.

The Clad insert — part of a joint venture between Esquire's publisher, Hearst Magazines, and Growth Brands, a division of J. C. Penney — will appear four times a year, while the magazine will make more frequent recommendations on the shopping site.

If you remember back to Sex Ed, the examination of the mechanics of sex were just that, a step by step guide to inserting one part of the body into anther part of someone else's body.

In aggression assays, mutant males insert parts of the courtship ritual (singing and attempted copulation) in an experimental situation in which only aggression should be seen.