Your English writing platform
Discover LudwigExact(3)
In summary, the APL1A1 haplotype bears the deleted variant of an indel located in exon 2, while APL1A2 bears the inserted variant for this indel.
APL1A2 bears the deleted variant of an indel located 5' to the predicted translation start site, while APL1A1 bears the inserted variant of this indel (Figure 4B).
Benchmarking on sequence files generated from a target enrichment panel that was based on known disease-associated genes revealed that 97%% of samples had the inserted variant as the top hit, regardless of inheritance model.
Similar(57)
A perturbed diploid genome is generated by inserting variants into a user-provided reference genome (e.g. GRCh37).
After five rounds of selection, the clones from the cycle that exhibited the highest number of colony-forming units (cfus) were isolated and analysed to verify the integrity of the inserted cry8ka1 variant genes via colony PCR using the Cry8Ka1sfiF and Cry8Ka1sfiR primers (described above).
Target specificity of L1 for TT/AAAA is not high, and most of L1 (and Alu and SVA) are inserted into variants of TT/AAAA.
Site-directed mutagenesis to insert the variant corresponding to human P308Q was performed with QuickChange XL kit (Stratagene, Amsterdam, The Netherlands) according to manufacturer's instruction, using primer forward ATCCTGAGAGTGGACCAAACCTTTGACAAGGAC and reverse GTCCTTGTCAAAGGTTTGGTCCACTCTCAGGAT.
In addition, we could amplify only kita insert variants from pooled cDNA of golden mutant N2 offspring.
Ping16A_Stow, located on chromosome 1 (2640500–2640502), is comprised of the Ping16A variant inserted in a 769-bp Stowaway element (Fig. 4a).
The histone variant H2AZ and likely other histone variants are inserted into assembled nucleosomes by histone variant exchange complexes (HVE) such as SWR1.
Although functional Gα fusion proteins have been prepared by inserting GFP variants into their α-helical domains [ 204, 205], FRET experiments in intact cells also led to controversial results [ 177, 178].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com