Sentence examples for inserted to create the from inspiring English sources

pLAY406 was digested with Bgl II and the Bam HI/Bgl II hisG-URA3-hisG universal disruptor fragment inserted to create the plasmid pLAY411.

The primers TTCACATTGCATGTGTGTGG and TAGCCTGCGTAGTGTTGGTG amplify a 423 bp fragment from the normal sirt1 allele while a 526 bp fragment from the null allele is amplified from the first primer and ATTTGGTAGGGACCCAAAGG, a sequence derived from the pgk-1 gene inserted to create the null allele by homologous recombination.

The oligonucleotide fragment encoding the Flag-tag (Invitrogen) was inserted to create the pcDNA-Flag-apoptin plasmid encoding apoptin fused with a Flag-tag at its N terminus.

An important feature of the technology is the simplicity of determining exactly where in the BAC DNA the loxP- or lox511-transposon inserted to create the truncation [ 7, 8].

The outside of the towers still have the putlog holes from their original construction, where timbers were inserted to create a spiralling ramp for the builders.

An EPS foam block was inserted to create a hollow cross-section of the specimen so as to enhance its torsional resistance and reduce its self-weight.

The plasmid pB [SCS-SCS'] was digested with SalI and a XhoI- ScaI fragment containing the GMR enhancer [ 24] inserted to create pB [SCS-GMR-SCS'].

Figure 9 The additional links that need to be inserted to create G 2 from G are shown in this figure.

The DraIII methyltransferase gene draIIIM was inserted into pACYC184 to create the plasmid pACYC184-draIIIM.

The DraIII endonuclease gene draIIIR was inserted into pAGR3 vector to create the plasmid pAGR3-draIIIR.

Three white and one black polyurethane boards could be inserted into the pool to create the square-shaped arena.