Sentence examples for inserted the following from inspiring English sources
They inserted the following text into the specific paragraph that addresses debt management: "Maintaining sustainable debt levels is the responsibility of the borrowing countries … " It is plainly obvious why this language is harmful and, given the situation in Greece, callous for the EU to even propose it.
We inserted the following annealed oligonucleotides between the Bgl II/Hind III sites of either pENTR/pTER+ or pENTR/pSUPER+: For Asf1a: 5'GATCCCGTGAAGAATACGATCAAGTGTGTGCTGTCCACTTGATCGTATTCTTCACTTTTTGGAAA and 5'AGCTTTTCCAAAAAGTGAAGAATACGATCAAGTGGACAGCACACACTTGATCGTATTCTTCACGG, where the underlined sequence is specific for human Asf1a.
To illustrate the typical outbreaks of wild-type and resistant infections, we inserted the following parameter values: γT = 0.0036 day−1; γU = 0.00036 day−1; δr = 0.2; δrH = 0.9; which correspond to probability 5×10−4 that a treated individual infected with the wild-type virus develops drug-resistance with high transmission fitness.
Authors' response: We've inserted the following paragraph into the text to address these questions:"Speculation on the mechanisms underlying this co-option event might be premature.
We inserted the following statement into the Discussion to address this important point: "Previous torsinA loss-of-function models also demonstrate cell loss restricted to a neurodevelopmental window (Liang et al., 2014).
We've inserted the following into the text to address the second part of this comment: "If the Hox genes were truly co-opted into the Wnt pathway, it is difficult to say whether the they were co-opted prior to the last common ancestor of cnidarians and bilaterians or subsequently, in the lineage leading to the last common ancestor of bilaterians.
FN23 In place of the word "instrument," the transcript inserts the following words: "Constitution, as finally amended, as follows". The Constitution is then inserted.
(Spin off into a new series?) CBS Television Stations Division Picking up on the success of the Bush "subliminable" ad that flashed "-RATS" into an anti-Gore ad, we will insert the following messages into prime-time programming on each of our 35 television stations: YOU ARE GETTING SLEEPY.
In September 1955 the section was amended by deleting the italicized clause and inserting the following: 'and merchandise or agricultural products shipped from outside of this state and held in this state in a warehouse or a place of storage for storage only and for shipment outside of this state are not used in business in this state.' 126 Ohio Laws, p. 78.
We insert the following data into the ROOT lookup table where ID is the fragment identifier, Name is the fragment name, S is the fragment size in number of tuples, and Host is the name of the server where the fragment is assigned to.
