Sentence examples for inserted similarly from inspiring English sources

A cleaved multimode fiber of core diameter 200 μm (Thorlabs, BFL37-200) walsolso inserted similarly into the micro-capillary in order to achieve uniform illumination in a liquid environment.

After digestion with the appropriate restriction enzymes the PCR products were inserted into similarly digested pDXC61M.

The tagless Pf SHI gene was amplified with primer pair 0891-NdeF (GandGGTTCCATATGAGGTATGTTAAGTTACCCAAGGA) and 0894-KpnR (ATAGGGTACCTTAAAGTCTAACCACGTGGACTGAGC), the NdeI/KpnI digested PCR product was inserted into similarly treated pET-A to produce pET-A-SHI.

The amplified DNA fragment was digested with EcoRI and XholI and was inserted into similarly digested pET-24a (Novagen).

The 3' UTR region of unc-10 was amplified using oligonucleotides 4651 and 4652, digested with BsiWI and SgrAI and inserted into similarly digested NM2703.

The product (ca. 12.3 kbp) was digested with NotI and inserted into similarly digested pBeloBAC11 (New England Biolabs, GenBank accession U51113).

The ptrn-1 promoter was amplified using oligonucleotides 4828 and 4829 digested with SbfI and NotI and inserted into similarly digested NM2705.

The fragment was digested with NcoI/SpeI and inserted into similarly digested pCAMBIA1302 to produce pCAMCO, which allows the overexpression of CrCO.

NM2703 pCFJ151 Prab-3::MCS.rry::mcherryherry was amplified from pCFJ104 (Frokjaer-Jensen et al., 2008) using 4218 and 4533, digested with XhoI and AvrII and inserted into similarly digested NM2498.

The myo-3 promoter was amplified from pCFJ104 with oligonucleotides 4220 and 4221, digested with SbfI and NotI and inserted into similarly digested NM2704 replacing the rab-3 promoter.

The obtained amplicons were purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) digested with NdeI and HindIII and inserted into a similarly digested pET28a vector.