The inserted parts of all screws were conical with a maximum diameter of 6 mm and 40 mm long.
Therefore, the P. aeruginosa chromosome presents a picture of a mosaic, consisting of a conserved core component, interrupted in each strain by the inserted parts of the accessory genome.
After a year of inserting part of the virus's DNA into target cells, the cells showed almost no signs of cancer.
Crabs crack the shells with their pincers and starfish use their water vascular system to force the valves apart and then insert part of their stomach between the valves to digest the bivalve's body.
A cloning intermediate, php15, was created by inserting part of the human ODC 5' UTR (accession NM_002539) amplified using primers (ODCHP F, GATTACAAAGCTTCTCGAGGGGCGAATACGAATTCGTCA and ODCHP R, GATTACAAAGCTTTTAATTAAGGATCCGTCTTCCCGCCGCC) into the HindIII site of pGL4.15cmv.
Studies in plant physiology, confirm that fructan, for example levan has a direct protective effect and capacity to stabilize membranes during drying by inserting part of the polysaccharide into the lipid headgroup region [ 20].
In the chaperone subunit complexes, the chaperone inserts part of a β-strand (strand G1) in the subunit's groove and thus complements in trans the incomplete fold of the pilus subunit, a process called donor-strand complementation (Choudhury et al, 1999; Sauer et al, 1999).
The Clad insert — part of a joint venture between Esquire's publisher, Hearst Magazines, and Growth Brands, a division of J. C. Penney — will appear four times a year, while the magazine will make more frequent recommendations on the shopping site.
This was inserted as part of the editing process.
Broadly, the pasting of the plaintiff's face on the body of a younger woman was inserted as part of some salacious display.
