Sentence examples for inserted by using from inspiring English sources
The size of the packet (frame) was set to 10 ms (160 samples for the wideband signal) and random packet (frame) losses were inserted by using the error insertion device (EID) in ITU-T G.191 software tool [30], which uses Gilbert and Bellcore models, with zero bit error rate and 0.5 of burst factor in which 0 and 1 indicate the totally random and burst error, respectively.
I have explained the concept of coronary stenting and the restenosis process that can occasionally cause scar tissue to build up inside a stent after it has been inserted by using the vice president's situation as an example.
Magnetic levitation is inserted by using rare earth permanent magnets, the repelling force of magnets are used to suspend the rotating part of both the turbine and generator.
These devices provide stable fixation in osteopenic bone, are adaptable to different types of fracture and prosthesis, and can be inserted by using a minimally invasive approach.
The RISN was inserted by using the previous skin incision and mini-arthrotomy from the open femoral box taking due precaution to avoid hyperextension deformity by avoiding the posterior starting entry point [24].
Human-NR2E3 cDNA was inserted by using EcoRI and XhoI sites of pGEX4T1 and pET21-PIAS3 was described previously (Ban et al, 2011).
After topical pharyngeal anesthesia, the activated and calibrated WC (Bravo wireless pH capsule system, Medtronic Inc., Minneapolis MN) was inserted by mouth using the single-use Delivery System to 5 cm above the proximal border of the LES.
A strong Kozak sequence was also inserted by PCR using 5'CCCAAGCTTGCCGCCACCATGTGGGCTCAGCTCCTTCTAG and 5'GAGAAGCCAAGGGAAACCTG primers.
BamHI and EcoRI restriction sites were inserted by PCR using the following primers: forward, 5′-AAGGATCCAAA ATGGCTGAAGTGAAAACC-3′ (start codon underlined), and reverse, 5′-GCCGAATTCTTTACTGAGTAAAGTAGAACC-3′.
For each trap line, tissue PCR [ 113] was performed to confirm the insertion site and determine the orientation of the inserted element by using a gene-specific primer and a uidA specific primer.
TiAlN, CrAlSiN and TiAlSiN coatings were deposited on tungsten carbide milling inserts by using cathodic arc evaporation.
