Sentence examples for inserted by two from inspiring English sources

Exact(4)

Mouse full-length Hist1h3a (encoding H3.1) and H3f3a (encoding H3.3) were obtained using cDNA from mouse ESCs (with a 3× Flag-tag inserted) by two PCR amplifications and subsequently ligated into the pENTR/D-TOPO vector (Life Technologies).

The wires were inserted by two orthopaedic registrars, five specimens each, under the supervision of a consultant surgeon experienced with the insertion of such wires in circular frame surgery.

Partly at issue on this vote was the fact that written material recently inserted by two Democratic members was incorrectly identified as speeches actually delivered.

This tag was inserted by two rounds of CD tagging into two genes, one expressed in the nucleus and the other expressed in the entire intracellular volume.

Similar(56)

In Figure 7b,c,d,e, we can see the accent and phrase commands inserted by the four methods.

Therefore the reporter was inserted by recombineering into two different fosmids, one extending further upstream of unc-62, the other further downstream, but both including at least 2 kb either side of the protein coding region.

In the Mandarin Richard III, short English phrases were inserted by actors playing the two murderers for more immediate comic effect.

The desired tag was also inserted by PCR-mutagenesis using two primers to amplify the whole plasmid along with the tag sequence.

HBO, a unit of AOL Time Warner did not have a full explanation, though executives said they were sure the image was not inserted by the producers of "Six Feet Under" -- or intentionally by anyone else involved with the program.

He would shatter this brief spell by inserting two or three short arpeggios, disconnected and broken off, then he would float into a loafing half time and shoot into another climbing-and-falling double-time run, in which he would dart in and out of nearby keys.

Mice were scanned for the presence of the insert by two PCR reactions using two pairs of primers for amplification of the promoter region (sense: AAAGGAGATATACCGCGGCGATATCCC, antisense: CTGCAACCTTGAACTCTCGGACATCAC, 630 bp) and the myc-galectin-8 coding sequence (sense: CGCCAATAGGGACTTTCCATTGAC, antisense: CTAATTACAGCCCGAAGGAGAAGG, 970 bp).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: