Sentence examples for inserted at the end from inspiring English sources

Suggestions(1)

Exact(41)

(The cat, in this meme, was inserted at the end of another video to signal a person's time in the limelight was over with a vaudeville-style playoff).

But "No surrender", as well as its own song, is inserted at the end of the third line of the national anthem by the many for whom the Good Friday agreement never happened.

Data are inserted at the end of the list.

The palatal expander was removed 12 months after it was inserted, at the end of the retention period.

When a packet is newly sent or resent, it is inserted at the end of WAITLIST to record the transmission order.

After the timeStamp is updated and the dupCnt is set to zero, the packet is removed from RTXLIST and inserted at the end of WAITLIST.

Show more...

Similar(19)

The two inversion cassettes, te-erm and phl-et, were sequentially inserted at the ends of the Tg-110 insert in the reverse direction.

Then, two incomplete fragments of the tetracycline resistance gene, te (5' end) and et (3' end), which shared an overlapping region of approximately 1.1 kb, were inserted at the ends of the BAC1 sequences of iREX/BAC1 and of BEST310/BAC1.

These were passed through rat pyloris via a butterfly cannula and the perfusate collected by means of a tube inserted at the end of ileum.

CRISPR spacers correspond to prior episodes of phage and plasmid exposure, and are inserted at the leader end of the CRISPR sequence, while the leader-distal end spacers are more conserved [ 16, 17].

The DNA fragment containing the α- l-fucosidase gene was obtained by polymerase chain reaction (PCR) using primers, in which the NdeI restriction site was inserted at the 5'- end of the gene (GACGACGA CATATGCGCTACAGACAGGTTCACC) and XhoI restriction site at the 3'- end (CCTTCCTC CTCGAGCTACTCATTATACTCTACGACG).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: