Sentence examples for insert via from inspiring English sources

This is where games you download or insert via cartridge would show up, but it feels very work-in-progress.

The flexibility to insert via the round window requires a 0.7-mm maximum dimension at the proximal end of the array.

Clones were picked and confirmed to contain the insert via PCR amplification and sequencing with primers HSP1-F (TCAACTGCAACTACTGAAATCTGCCA) and HSP1-R (ACACAGATCAGCCGACTGCGAA; intron-anchored).

The HM insert was generated from the HP insert via multiple rounds of PCR.

We propose that instead of paying such an entropic penalty, structures with already extended lipids (see intersections of p(r) in s1 and s2) would selectively and spontaneously insert via the conformational selection mechanism.

The procedure enables rapid generation of a large collection of BACs ready for transgenesis with the iTol2 cassette at the new end of a progressively truncated genomic insert via lox-Cre recombination.

22, 3 49 p.m. | Insert | Via Twitter, the energy blogger Adam Siegel reminded me to include a link to Smalley's essential 2004 paper "The Terrawatt Challenge," as well.

Additionally, prior to any ECMO cannulae insertion, a pulmonary artery catheter was inserted via an internal jugular vein route.

Three catheters were inserted via the femoral vein, and three central line insertions did not follow the precaution of maximal sterile barrier during insertion.

Many of these resistance-related genes were flanked by insertion sequence (IS) elements; in particular, cat (PCN033p3_223) was inserted via an IS 6 element (Fig.  5).

In early-voting states, the ads, inserted via the Internet in Madden NFL '09, Burnout Paradise and other games, reminded hard-to-reach young people to cast ballots.