Sentence examples for insert using the from inspiring English sources

We tested the recognition of all the peptides that would be included in 3 vaccine inserts and found that maximizing coverage in the vaccine insert using the COT+ method was useful to increase the number of peptides recognized.

Fig. 6 a e Comparison of differential DVHs obtained in the cylindrical insert using the three voxel-based dose algorithms.

As a comparison, we typically achieved approximately 1,200∼1,500 c.f.u per nanogram of control insert using the ligation method.

T7 promoters were incorporated onto ends of this fragment by amplifying the cloned insert using the following primers: M13F-CTCGAGTAATACGACTCA CTATAGGGCTAGTAACGGCCGCCAGTGT and M13R-CTCGAGTAATACGACTCACTA TAGGGGCCAGTGTGATGGATATCTGC.

Digoxigenin-labeled antisense and sense probes were prepared by in vitro transcription of the amplified cDNA insert using the DIG RNA Labeling Kit (Roche) and T7 (sense) and SP6 (antisense) RNA polymerases.

Products were cloned into the pCR2.1-TOPO vector according to the manufacturer's instructions and the resultant colonies were screened for the proper insert using the PCR protocol described above.

The insert uses the output from conventional NMR amplifiers for heating conductive aqueous samples with a rate of 30 80 K/s for 200 W radiofrequency power.

In group Index (I), the silicone LMA was inserted using the index finger insertion technique and in group Thumb (T), the silicone LMA was inserted using the thumb insertion technique.

First, peripheral lines placed under US guidance have a shorter duration than those inserted using the traditional technique [8, 10, 18].

The black dots indicate the locations where the blocking screws should be inserted using the reverse rule of thumb.

The self-threading screws were inserted using the specific screwdriver according to the surgical technique in order to completely insert the screw into the hole of the plate.