Sentence examples for insert the following from inspiring English sources

(Spin off into a new series?) CBS Television Stations Division Picking up on the success of the Bush "subliminable" ad that flashed "-RATS" into an anti-Gore ad, we will insert the following messages into prime-time programming on each of our 35 television stations: YOU ARE GETTING SLEEPY.

Simply we insert the following part of Boolean algebra in Ontology based.

We insert the following data into the ROOT lookup table where ID is the fragment identifier, Name is the fragment name, S is the fragment size in number of tuples, and Host is the name of the server where the fragment is assigned to.

Finally, we insert the following in-degree inequalities, ∑ kl ∈ A x kl ≤ 1 ∀ l ∈ S ⧹ { r } and the sub-tour elimination constraints of size two, x kl + x lk ≤ 1 ∀ { k, l } ∈ E, k, l ∈ S, k ≠ r.

At their June 1989 national convention, the ACA delegates voted "decisively" to insert the following passage into their 'Master Plan': "Chiropractic is a drug-free, non-surgical science and, as much, does not include pharmaceuticals or incisive surgery" [ 4].

Go back to and insert the following.

They inserted the following text into the specific paragraph that addresses debt management: "Maintaining sustainable debt levels is the responsibility of the borrowing countries … " It is plainly obvious why this language is harmful and, given the situation in Greece, callous for the EU to even propose it.

We inserted the following annealed oligonucleotides between the Bgl II/Hind III sites of either pENTR/pTER+ or pENTR/pSUPER+: For Asf1a: 5'GATCCCGTGAAGAATACGATCAAGTGTGTGCTGTCCACTTGATCGTATTCTTCACTTTTTGGAAA and 5'AGCTTTTCCAAAAAGTGAAGAATACGATCAAGTGGACAGCACACACTTGATCGTATTCTTCACGG, where the underlined sequence is specific for human Asf1a.

The GFP-specific shRNA in the pBSU6 vector was previously described [58], and the two NFAT5-specific shRNAs were done by inserting the following 21-nucleotide sequences complementary to NFAT5 mRNA in pBSU6: shNFAT5-1 (shN5-1), 5'-GGT CAA ACG ACG AGA TTG TGand'; and shNFAT5-3 (shN5-3), 5'-GGT CGA GCT GCG ATG CCC TCCC3'.

To illustrate the typical outbreaks of wild-type and resistant infections, we inserted the following parameter values: γT = 0.0036 day−1; γU = 0.00036 day−1; δr = 0.2; δrH = 0.9; which correspond to probability 5×10−4 that a treated individual infected with the wild-type virus develops drug-resistance with high transmission fitness.

We used a mutated sequence by inserting the following oligonucleotides (Integrated DNA Technologies Inc).: sense, 5- CTAGTTTAACTCTTCCACGCCCGAGGGATCCA-3; and antisense, 5- AGCTTGGATCCCTCGGGCGTGGAAGAGTTAAa-3.