Sentence examples for insert parts of from inspiring English sources

In aggression assays, mutant males insert parts of the courtship ritual (singing and attempted copulation) in an experimental situation in which only aggression should be seen.

After prosthesis removal, and meticulous debridement and irrigation, the first pack of cement was poured into the prefabricated molds to cast the femoral and insert parts of the spacers.

Insert parts of the song in appropriate places.

The Clad insert — part of a joint venture between Esquire's publisher, Hearst Magazines, and Growth Brands, a division of J. C. Penney — will appear four times a year, while the magazine will make more frequent recommendations on the shopping site.

Crabs crack the shells with their pincers and starfish use their water vascular system to force the valves apart and then insert part of their stomach between the valves to digest the bivalve's body.

In general, peptides associate with HLA molecules by inserting parts of their amino-acid residues into a set of six binding pockets (termed A F) in the HLA9.

The inserted parts of all screws were conical with a maximum diameter of 6 mm and 40 mm long.

Therefore, the P. aeruginosa chromosome presents a picture of a mosaic, consisting of a conserved core component, interrupted in each strain by the inserted parts of the accessory genome.

After a year of inserting part of the virus's DNA into target cells, the cells showed almost no signs of cancer.

A cloning intermediate, php15, was created by inserting part of the human ODC 5' UTR (accession NM_002539) amplified using primers (ODCHP F, GATTACAAAGCTTCTCGAGGGGCGAATACGAATTCGTCA and ODCHP R, GATTACAAAGCTTTTAATTAAGGATCCGTCTTCCCGCCGCC) into the HindIII site of pGL4.15cmv.

The inserted part of the catheter was about 2 cm so it could reach the lumbar enlargement of the spinal cord.