Sentence examples for insert including from inspiring English sources

Exact(10)

Mr. Baker said that major newspapers would include it as a paid insert, including The Milwaukee Journal Sentinel, The Cleveland Plain Dealer and The Des Moines Register.

To further characterize these cell lines, we used qRT-PCR (Fig. 3A), to examine a panel of markers representing several ExEn lineages (Fig. 1G and Fig. 3, insert) including PrE, PE, VE and anterior visceral endoderm (AVE).

(pAH15 is derived from pKC31 and contains an 18 bp insert including a XhoI restriction site [11].) This deletes λ base pairs 40,621 41,073, and inserts 21 bp including an NheI restriction site to create a net deletion of 432 bp.

The genomic region corresponding with the NP225-GAL4 includingncluding the mdg3 natural transposon (see Figure 2B), was PCR amplified from NP80-GAL4 genomic DNA (which also contains the mdg3 element in this location) using NP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTG) aNP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTGs.

The cloning junctions and entire MpXyn10A insert (including the CBM1 and catalytic domains) were sequenced and transformed [ 32] into A. nidulans strain A773 (pyrG89, wA3, pyroA1).

This procedure should be applicable to a wider variety of BACs containing lox sites flanking the genomic DNA insert, including those with sequence repeats.

Show more...

Similar(50)

The fine print could be on the outside of a packaging box, on a paper insert included with the product, or on the product itself.

This is most likely due to the size of MexX and MexY together is greater than 4 kb, the largest size of genomic insert included in the selections.

For rat Cyp2j4, the insert included nucleotides 1188 to 1585 (NM_023025); for rat Cyp27a1, the insert included nucleotides 1361 to 1766 (NM_178847), both with respect to the translation initiation start site.

L. 88 205 inserted "including orientation".

L. 100 690, § 5105, inserted "(including any leasehold interest)" after "interest".

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: