Sentence examples for insert by two from inspiring English sources
Mice were scanned for the presence of the insert by two PCR reactions using two pairs of primers for amplification of the promoter region (sense: AAAGGAGATATACCGCGGCGATATCCC, antisense: CTGCAACCTTGAACTCTCGGACATCAC, 630 bp) and the myc-galectin-8 coding sequence (sense: CGCCAATAGGGACTTTCCATTGAC, antisense: CTAATTACAGCCCGAAGGAGAAGG, 970 bp).
Mouse full-length Hist1h3a (encoding H3.1) and H3f3a (encoding H3.3) were obtained using cDNA from mouse ESCs (with a 3× Flag-tag inserted) by two PCR amplifications and subsequently ligated into the pENTR/D-TOPO vector (Life Technologies).
The wires were inserted by two orthopaedic registrars, five specimens each, under the supervision of a consultant surgeon experienced with the insertion of such wires in circular frame surgery.
Partly at issue on this vote was the fact that written material recently inserted by two Democratic members was incorrectly identified as speeches actually delivered.
This tag was inserted by two rounds of CD tagging into two genes, one expressed in the nucleus and the other expressed in the entire intracellular volume.
After every ten components being machined, the boring bar insert must be compensated for the wear by elevating the insert by about five micrometers, over the diametric dimension.
Long insertion/deletion events were inferred when the distance between the aligned forward and reverse read pairs was larger or shorter than the library insert size by three times the standard deviation.
Make one "insert" by cutting away about two thirds of the side of one plastic flowerpot.
Unfortunately, integrative recombination is highly inefficient because the insert is flanked by two loxP sites, which themselves become targets for Cre and lead to subsequent excision of the insert.
The V3 loop insert is dominated by two type I β turns.
An insert is flanked by two inward-facing BsaI sites, and the sequence to be replaced in the destination vector is flanked by two outward-facing BsaI sites.
