Sentence examples for insert a unique from inspiring English sources

By manipulating these parameters, it is possible to insert a unique pattern of information into a file, ideally without altering what it sounds like when played.The formal challenge was to remove the watermark from the second song, while maintaining its sound quality.

Site-directed mutagenesis (QuikChange II XL, Agilent) was used to insert a unique XhoI restriction site within the C2A C2B linker, in a frame chosen to encode two serine residues, using the following primers: fwd, CAGCGATGGGAGCTCGAGTGGGAGCCGAG; rev, CTCGGCTCCCACTCGAGCTCCCATCGCTG.

It inserts a unique question in some individual exam papers.

AT&T experimented last year with a similar ad-targeting program, which involved inserting a unique numeric code into a subscriber's web requests.

Moreover, we have overcome name mismatching by inserting a unique label for each partner.

This week, researchers discovered that smartphone carriers have started inserting a unique code into their customers' network activity so that their customers can be tracked as they browse the Web and use smartphone apps; Verizon uses a customer's unique tag to deliver personalized ads to users, and AT&T plans to do the same.

Furthermore, we inserted a unique oligonucleotide tag sequence in each phagemid of the Membranome collection, and generated two populations by panning the tagged collection on tumor and on normal tissue.

This occurs because transposon mutagenesis cleaves a gene into two fragments within the context of a single vector by inserting a unique NotI restriction site at different locations.

Subsequently, the constitutive GnTII/GalT expression cassette was inserted at a unique XbaI site and clones containing the insert in either orientation were identified by restriction mapping and designated pXLBacIIΔTSR-GalT/GnTII/-DsRed1.A cl 16 and pXLBacIIΔTSR-GnTII/GalT-DsRed1.B cl 13.

This was demonstrated by a system developed by Derr et al., the plasmid used in the study carries a his3 reporter gene whose coding sequence is interrupted by an artificial intron inserted at a unique MscI site in the antisense orientation relative to the HIS3 promoter [49].

A 1.9 kb non-polar kanamycin resistance cassette carrying the aphA3 gene was then inserted at a unique EcoRV site within MSMEG_6382.