Congress inserted a restriction in the federal budget that prevented the city from spending any money to implement the measure.
But Bowser's stance changed in December, when congressional Republicans inserted a restriction in a budget bill blocking the District from doing so.
This operation inserts a restriction S into a PQ tree T, modifying T such that T satisfies S in addition to all the previous restrictions inserted into T.
Several mcrBC homologues clearly occur as an insert into a restriction modification gene complex, which results in their linkage, as discussed above.
Phosphorylated oligonucleotides were designed to reconstitute the 160 base pair fragment and insert an AloI restriction site directly into the target sequence region.
His demurrer was sustained by the California Supreme Court, which held that compliance confronted respondent with 'substantial hazards of self-incrimination,' but upheld the statute by inserting a use restriction on the information disclosed.
The S. aureus sequence for strain MRSA252, which has been shown to be most closely related to UAMS-1 [28], was used to design an oligonucleotide primer (lrgA-pro-BamHI-F; 5'-CGCGGATCCGAATCGTTATGAAAAACGATTGAATCC-3') that annealed to the sequence starting 308 bp upstream of the lrgA locus while inserting a BamHI restriction endonuclease cleavage site at the 5' end of the fragment.
Medaka myc17 (ENSEMBL database identifier: ENSORLG00000007021) and myc20 sequences were PCR amplified from pooled medaka organ cDNA using ReproFast polymerase (Genaxxon) with primers inserting a HindIII restriction site downstream and a BamHI site upstream of the gene (for primer sequences, see supplementary material Table S3).
Site-directed mutagenesis (QuikChange II XL, Agilent) was used to insert a unique XhoI restriction site within the C2A C2B linker, in a frame chosen to encode two serine residues, using the following primers: fwd, CAGCGATGGGAGCTCGAGTGGGAGCCGAG; rev, CTCGGCTCCCACTCGAGCTCCCATCGCTG.
Insert DNA was removed with a restriction enzyme (NotI) at 37 °C for 16 18 h.
