Your English writing platform
Discover LudwigExact(18)
This indicates that the eruption associated with the inner pair of cavities is still occurring.
The fertile shoot of a microstrobilus has two pairs of bracteoles, the inner pair of which are fused, enclosing six microsporangiophores and a sterile ovule.
Certain particles are transferred to the mouth by the ciliary currents of the inner pair of palps, while the remaining particles are sent by the outer palps into the mantle cavity as a mucus-bound mass known as pseudofeces, which are ejected by periodic contractions of the adductor muscles.
In the case of larger animal subjects, it is not only possible to use a catheter with more than one inner pair of electrodes, but also it is possible to implant two catheters one in each ventricle [30].
The second (inner) pair of antennae are less than half the length of the first.
Sense1: GATGGATCCAAAACTACATGAAACCT and anti-sense1: CGTGACTCGAGC TGCTTCCTGC as outer primers and sense2: GATGGATCCAGCCTATTTAATACCAC and anti-sense2: CGTGACTCGAGAGTTAAGTTGATCTTGCAA as inner pair of primers to amplify a 650 bp fragment spanning the surface-transmembrane region of the envelope genes, (see Table S2 in the supplemental material for additional oligonucleotide primer sequences).
Similar(42)
The inner pairs of LEDs were vertically separated by 7.5º, whereas the outer LED pairs were 11.5º apart vertically.
The outer palp on each side bears a long, extensible proboscis with a ciliated groove that collects organic material, which is then sorted by the inner pair and outer pair of palps.
In some secondary plastids, constriction of the outer pair of plastid membranes takes place behind that of the inner pair [ 61].
There are two sets of jaws: the outer pair is used for carrying objects such as food and for digging, and the inner pair is used for chewing.
Hands were placed at the inner two cue locations, aligned with the inner two pairs of target lights, in half of the experimental blocks and at the outer two cue locations in the remainder.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com