Sentence examples for injection control from inspiring English sources

Exact(60)

Blank: without injection; Control: injected with 200 nL sterile endotoxin-free water; PGN-EB: injected with 200 nL PGN-EB solution; PGN-SA: injected with 200 nL PGN-SA solution.

Negative control morpholino (5′- CCTCTTACCTCAGTTACAATTTATA -3') was also injected for injection control.

Crude DNA was then prepared by lysing each of the 8 blastocysts derived from the RNA-injected zygotes and 1 blastocyst derived from a non-injected fertilized egg as a negative control (NIC: no injection control).

The left rear footpad was injected with the same volume of saline and served as the injection control.

Flies were injected with 50 nl of concentrated bead solution or water as an injection control.

The Administrator shall publish proposed regulations for State underground injection control programs within 180 days after December 16 , 1974

L. 96 502, § 4(c), substituted "effective on the date on which the applicable underground injection control program takes effect" for "effective three years after December 16, 1974".

This paper concerns fuel injection control of compressed natural gas engines.

Strategies to optimize fractures geometry are presented through injection control of each fracture.

For the purpose of this subparagraph, a regulation prescribed by the Administrator under this section shall be deemed to disrupt a State underground injection control program only if it would be infeasible to comply with both such regulation and the State underground injection control program.

In order to optimize the engine stability performance, the BDC control based on fuel injection control is investigated.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: