These changes are initiated by sequence-specific events, which trigger a cascade of molecular interactions resulting in feedback mechanisms, alterations in chromatin structure, histone posttranslational modifications (PTMs), and ultimately establishment of distinct transcriptional states.
A high-speed supernatant of egg cytoplasm (HSS) supports one round of efficient DNA replication of ssDNA plasmids initiated by sequence-independent priming (Mechali & Harland, 1982).
Binding of the MSL complex to the X chromosome is thought to be initiated by sequence-dependent targeting to 100 200 nucleation sites termed chromatin entry sites (CES) or high-affinity sites (HAS) (Alekseyenko et al. 2008; Straub et al. 2008, 2013).
Isolate identification was initiated by sequencing the 16S rDNA using colony PCR and the universal primers 27 F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT).
The analysis of the function of Pex11 in peroxisome proliferation was initiated by a sequence comparison of known Pex11 proteins for the presence of membrane deforming motifs.
The sequences for phylogenetic analysis were collected using (i) BLAST searches against nr and environmental (env_nr) databases initiated by Pandoravirus protein sequences; (ii) the corresponding NCVOG sequences [ 11]; and (iii) the corresponding mimiCOG sequences [ 16].
The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events.
Functional annotation was initiated by using each sequence as a BLAST query [ 78] against the NCBI Non Redundant database retrieved 2012-09-14 [ 79] (e-value < 1E-0.6) and the Uniprot SwissProt Fungi protein database retrieved 2012-04-30 [ 80] (e-value < 1E-0.7).
We excluded vocal sequences that occurred within 30 s of the beginning or end of the data record, which removed 40 vocal sequences initiated by male vocalizations and 17 vocal sequences initiated by female vocalizations from the analysis.
This question-answer sequence initiated by the younger player serves a different purpose from the question-answer sequence initiated by the older player.
The theory of regularly varying sequences (sometimes called Karamata sequences), initiated by Karamata [3] in the thirties, received a fundamental contribution in the seventies with the papers by Seneta et al. (see [4, 5]) starting from which quite many papers about regularly varying sequences have appeared, see [6] and the references therein.
