A total of 118 targeted questions was used to assess whether the 32 quality indicators were achieved.
Enhanced saccharide electrochemical sensing using dopamine cross-linked chitosan film on the electrode as an indicator was achieved by coupling indicator displacement assay (IDA) with a redox cycling.
For each indicator, the percentage of eligible patients for whom the indicator was achieved was calculated.
†Proportion of eligible patients across all 150 practices for whom the indicator was achieved.
25 The set of patients for each QOF indicator (all patients with SMI for MH6 and MH9, or all patients with bipolar disorder for MH4 and MH5) were divided into three mutually exclusive categories: those for whom the indicator was achieved (A), those who were exception reported (E), and those for whom the indicator was not achieved (NA).
The quality score for each indicator was that the number of times the indicator was achieved divided by the number of times it was triggered, expressed as a percentage, with possible values between 0 and 100%.
The quality score for each indicator was the number of times that that indicator was achieved divided by the number of times it was triggered, expressed as a percentage, with possible values between 0% and 100%.
In the validation phase of three studies, the proposed indicators were revised after discussion by physicians who were working on an HIV/AIDS control program as well as HIV care-providing facilities, for their local relevance and retained only the indicators where consensus was achieved [ 22, 27- 29, 31].
using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS).
Regarding indicators for TB suspects, consensus was achieved for importance and feasibility except the feasibility of one domain ("Transmission prevention", scored ≥7 by 68.8%) and one subdomain ("Interpersonal contact etiquette", scored ≥7 by 56.3%) (Table 4).
