Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
miRIDIAN™ hsa-miRNA-101 mimics and siGLO Green (transfection indicator) were from Dharmacon: hsa-miRNA-101 hsa-miRNA-101 hsa-miRNA-101GUGAUAACUGAA), hsa-5'-isomature1 (mature sequence: GUACAGUACUGUGAUAACUGAA, 3'biotinilated hsa-5'-isomiR-101ture sequence: UACAGUACUGUGAUAACUGAA-Bio) and 3'biotinilated hsa-5'-isomature1 (mature sequence: GUACAGUACUGUGAUAACUGA-Bio).
Similar(59)
The higher the mean, the more important this indicator was from the perspective of the participants.
Since the range in the mean scores for the quality indicator was from 0 to 9 points, 2.24 points therefore represents a maximum decrease of 24.9%.
Data on country-specific estimates and projections of family planning indicators were from an estimates and projections database of the United Nations Population Division (11).
At the other extreme, the countries with the highest human development indicators are, from the top, Canada, Norway, the United States, Australia, Iceland, Sweden, Belgium, the Netherlands, Japan and Britain.
Certain indicators are from an Executive Opinion Survey.
MitoTracker (mitochondrion-selective probe), MitoSOX (mitochondrial superoxide indicator), and CM-H2DCFDA (general oxidative stress indicator) were obtained from Invitrogen.
Because of the pressure from ILO, this indicator was dropped from Doing Business.
All these indicator strains were from our in-house collection of strains.
The indicator is compiled from surveys of the industrial, services, consumer, construction and retailing sectors.
The indicator is compiled from data on more than 1,500 Internet job boards, including Monster's, and corporate-career Web sites.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com