Sentence examples for indicator was achieved from inspiring English sources

Exact(6)

Enhanced saccharide electrochemical sensing using dopamine cross-linked chitosan film on the electrode as an indicator was achieved by coupling indicator displacement assay (IDA) with a redox cycling.

†Proportion of eligible patients across all 150 practices for whom the indicator was achieved.

For each indicator, the percentage of eligible patients for whom the indicator was achieved was calculated.

The quality score for each indicator was that the number of times the indicator was achieved divided by the number of times it was triggered, expressed as a percentage, with possible values between 0 and 100%.

The quality score for each indicator was the number of times that that indicator was achieved divided by the number of times it was triggered, expressed as a percentage, with possible values between 0% and 100%.

25 The set of patients for each QOF indicator (all patients with SMI for MH6 and MH9, or all patients with bipolar disorder for MH4 and MH5) were divided into three mutually exclusive categories: those for whom the indicator was achieved (A), those who were exception reported (E), and those for whom the indicator was not achieved (NA).

Similar(54)

Weighting of indicators was achieved by repetition of certain items in the evaluation process.

A total of 118 targeted questions was used to assess whether the 32 quality indicators were achieved.

using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS).

In the validation phase of three studies, the proposed indicators were revised after discussion by physicians who were working on an HIV/AIDS control program as well as HIV care-providing facilities, for their local relevance and retained only the indicators where consensus was achieved [ 22, 27- 29, 31].

In all additional simulations the strong effects of decline type and weaker effects of particular sampling strategy were apparent, and the best indicator remained K. Unsurprisingly, greater power was achieved for a decline from N = 10 000 to 50 than from N = 2000 to 50.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: