Your English writing platform
Discover LudwigSimilar(60)
Scotland, in its 10th independent presentation at the biennale, will present three artists based in Glasgow, none of whom are Scottish-born: watercolour painter Hayley Tompkins, and film-makers Corin Sworn and Duncan Campbell.
Presented by Howard Panter and Ambassador Theater Group, Tulchin/Bartner, Bill Kenwright, Northwater Entertainment, Darren Bagert, Tom Gregory, Nederlander Presentations Inc., David Mirvish, Michael Jenkins/Dallas Summer Musicals, Independent Presenters Network, Olympus Theatricals and Sonia Friedman Productions.
Primers and probes were Duffy F primer: CTGATGGCCCTCATTAGTCCTT, Duffy R primer: GCTGGGACGGCTGTCA, Duffy T allele: 5'VIC CTTCCAAGATAAGAGCC, Duffy C allele: 5'FAM CCAAGGTAAGAGCC. From 1998 to 2005 (7 years) there were 19,162 independent clinical presentations by 2,545 individuals (Range 1 51 per person; mean 7.5 and median 5).
Each region received statistically independent stimulus presentations at a mean rate of 1/s/stimulus region.
Maggie Gyllenhaal hosts this "Independent Lens" presentation.
At delayed recall, participants in both studies recalled more story elements in the slow versus fast story independent of presentation conditions.
In this "Independent Lens" presentation, Lydia Nibley examines the events leading up to Fred's death and the "two spirit" tradition among American Indian tribes.
On 8 May, general manager Steve Owen sent an email to his staff requesting detailed spreadsheets for his upcoming independent monitor presentation "without any reference to the April 2 , 2012base reforecast", which suggested the plant would bust its budget.
"Hell and Back Again," an "Independent Lens" presentation at 9 30 on Channel 13, follows Sgt. Nathan Harris of the Marines as he transitions to civilian life after a life-threatening injury in Afghanistan.
10 P.M. (13) DETROPIA (2012) In this "Independent Lens" presentation, the filmmakers Heidi Ewing and Rachel Grady cast an appreciative eye on the postindustrial blight in Detroit as longtime residents reminisce about that city's glory days and newcomers lured by bargain-basement real estate offer hope for renewal.
Finish your MP or independent study presentation before the start of block D. Primitive Camping: Multi-night backcountry camping.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com