Sentence examples for incorporates a variable from inspiring English sources

The model incorporates a variable that represents terrain morphology by a single number.

In contrast, the effort-moderated IRT model proposed by Wise and DeMars (2006) incorporates a variable derived from response time to indicate solution behavior and whether or not the regular IRT model holds for a particular item-person combination.

A self-adaptive heuristic that incorporates a variable level of perturbation, a novel local search and a learning mechanism is proposed to solve the p-centre problem in the continuous space.

In this sense, only model BSSVS incorporates a variable selection step, which can actually be used for QTL mapping purposes e.g. [ 11, 23].

To reduce the effect of anterior segment polarisation, the newest GDx generation incorporates a variable corneal compensator (VCC) that enables compensation of the anterior segment birefringence (ASB) in each individual eye [ 21].

The Reverse primer (5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXGTAGCCCCTTGAATTCCGAG-3') anneals in a region common to all shRNAs and incorporates a variable 5 bp index to enable multiplexing of samples, the P5 Illumina adapter sequence and the sequencing primer site.

As a demonstration of the usefulness of this approach, we have incorporated a variable segmented transmission line into a home-built Variable Angle Spinning probe.

This is achieved by decreasing the actions that a node needs to perform at the start of every communication period and by incorporating a variable radio-on operation.

Two hybrid heuristics are proposed to solve the problem, namely SAVNS and TSVNS which incorporate a variable neighborhood search (VNS) algorithm into the framework of simulated annealing (SA) and tabu search (TS).

When modelling absolute treatment effects across individuals, the assumed model usually has incorporated a variable benefit, but a fixed harm.

The formula incorporated a variable for whether a person had a privately funded inpatient episode of care provided by the NHS in the previous two years: this had a negative impact on costs as expected.