Suggestions(2)
Exact(8)
He comes with a team that includes a forward air controller, who can call in airstrikes from the big planes doing Daytona 500 loops high in the sky.
The algorithm includes a forward and a backward phase.
The inversion algorithm includes a forward numerical modeling of fluid flow to obtain experimentally derived relative permeability curve.
As in neural network, the learning algorithm of ANFIS includes a forward pass and a backward pass.
The RREP includes a forward path that was not used in any previous RREPs for this route discovery.
The FarmLead app also includes a "forward contracting service and escrow payment option," which helps growers sell to buyers based on their projected grain yield.
Similar(52)
Click the checkboxes under the "Forward Email to a Friend" heading to include a "Forward Email" link to your email and a "Subscribe me! " link in your forwarded email.
To enhance system performance, various coding schemes were also introduced, including a forward error correction coding scheme in [15] and a rate-delay trade-off network coding scheme in [18].
The 40-plus essays in the book, including a forward by Janet Yellen, showcase a host of remarkable innovations that are transforming financial lives in communities across the country.
And the Center for Naval Analyses called climate change a national security concern last year in a report that included a forward from former Homeland Security Secretary Michael Chertoff, who served under President George W. Bush, and former Obama Defense Secretary Leon Panetta.
The second set included a forward primer AAGAGCTGCTTGTGTGGTATTGCC and a reverse primer TCACACTGTGCTCCTTCTTTGGGA with a product of 171 bp.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com