Sentence examples for includes a cocktail of from inspiring English sources

Our knowledge concerning the predominant controls on the cycling of leaf litter far outweighs that for rhizodeposition even though the constituents of rhizodeposits includes a cocktail of low molecular weight organic compounds which represent a rapidly cycling source of carbon, readily available to soil microbes.

But Rodchenkov's revelations had their intended effect: ordered by the International Olympic Committee to investigate his claims, Wada reported in July that the Russian government colluded across multiple agencies and authorities to cover up widespread use of performance-enhancing chemicals including a cocktail of the anabolic steroids metenolone, trenbolone and oxandrolone.

Firstly, the panCTC gene panel included a cocktail of eight epithelial markers, increasing the sensitivity of detecting epithelial marker expression.

Tissue lysates were prepared by homogenization in RIPA lysis buffer (20 mmol/L Tris HCl, 150 mmol/L NaCl, 1 mmol/L Na2EDTA, 1 mmol/L EGTA, 1% Triton, 0.1% SDS, 0.1 sodium deoxycholate, pH 7.4) including a cocktail of protease inhibitors (Roche, West Sussex, UK) and subjected to three freeze thaw cycles in liquid nitrogen.

The $38 prix-fixe menu is served 5 30 to 6 30 p.m. includes a cocktail or glass of wine along with an appetizer, main course and a selection of macarons for dessert.

The $20 cover includes a cocktail or glass of wine.

The twenty-five-dollar admission included a cocktail, snacks, and plenty of promising new adult playdates.

Most of the items in the shop have a maritime theme, including a cocktail shaker in the form of an oil lamp ($165), a silver serving dish shaped like a shell ($50), Nantucket baskets ($250) and a miniature of the U.S.S.

We found that BTH_s19 accumulated in B. thailandensis exposed to a sub-lethal dose of kanamycin included in a cocktail of antibiotics to which the bacteria is naturally resistant, whereas BTH_s19 levels were significantly reduced in bacteria exposed to inhibitory concentrations of kanamycin.

Every other case involved the presence of additional substances, sometimes including a dangerous cocktail of prescription drugs, heroin and other potent opioid analogs like fentanyl.

The primers used in this study to amplify COI included a primer cocktail of two forward primers: LepF1 - ATTCAACCAATCATAAAGATATTGG, LCO1490 - GGTCAACAAATCATAAAGATATTGG; and two reverse primers: LepR1 - TAAACTTCTGGATGTCCAAAAAATCA, and HCO2198 – TAAACTTCAGGGTGACCAAAAAATCA [ 58, 59], for full-length barcodes.