Sentence examples for in their first position from inspiring English sources

Let ψ ( n ) be the number of Boolean vectors of length n that do not contain isolated 1s, except possibly in their first position.

98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.

The DNA code is redundant so that triplets that differ only in their third position do not affect which amino acid is specified, so from this perspective all the redundant variations are included in the same partial genotypic class.

Daylight revealed the weakness of the light horse defenders in their second position on Wellington Ridge and that their right was outflanked by strong German and Ottoman forces.

At Oxford University, only about 15% of STEM students stay in the field for their first position after university, either in research or in engineering and manufacturing organisations.

Abstract: The National Resident Matching Program is a centralized clearinghouse through which new medical graduates in the U.S. obtain their first positions.

The National Resident Matching Program is a centralized clearinghouse through which new medical graduates in the United States obtain their first positions.

Indeed, the team won more points without him and maintained their fourth position in the league.

The Lurgan Blues lie four points behind Warren Feeney's outfit and are threatening their second position in the league.

By 03 30, all light horsemen south of Mount Meredith had been forced back to their led horses and had succeeded in disengaging and falling back to their second position.

Notably, efficient codons are particularly enriched with Cytosines (over Guanines) in their third-base positions (additional file 1, Figure S2), and are depleted the 5' ends of genes [ 17, 18].