Sentence examples for in their commencing from inspiring English sources

Annually, all enrolling medical students at all Australian medical schools, and the two New Zealand medical schools, are invited to participate in the MSOD project, and are then asked to complete a short questionnaire in their commencing, final and selected postgraduate years.

Data collection in their study commenced in 2000.

Heath et al. [ 90] reported that eight out of 10 children and adolescents treated initially with intravenous oestrogen and then oral oestrogen after 2 or 3 days had a significant reduction in their symptoms after commencing therapy.

There would be nothing stopping UK airlines from stipulating the country in which court proceedings must be commenced in their terms and conditions – meaning UK passengers would need to find a solicitor in Lithuania or Lebanon, or wherever else the airline chooses".

However, about 88.3% of these doctors are keen in participating in such an activity, if it were to be commenced in their ward.

Clinicians believed that centres needed to be sufficiently incentivised by health systems to provide home haemodialysis at rates comparable with in-centre haemodialysis before home haemodialysis could be commenced in their centres.

Once local R&D approval have been granted and evidence provided to the PEARLS Central Office, the local Principal Investigator will receive a folder containing all the necessary materials to allow the trial to commence in their unit.

Trinkoff et al. [ 34] demonstrated an increase in musculoskeletal disorders of the neck, back and shoulders in their longitudinal study of nurses commencing shifts of 13 hours or longer.

In contrast, in the criminal law bid round involving a similar number of firms, all but a small minority were successful in their applications for contracts which commenced last month.

Almost all participants first tried illicit substances in their teens and fifteen had commenced drug use before developing mental health problems.

98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.