Sentence examples for in that contained from inspiring English sources

To synthesize biotinylated 3'UTR RNAs corresponding to the SASP mRNAs, PCR fragments were prepared using forward primers as in that contained the T7 RNA polymerase promoter sequence [(T7), CCAAGCTTCTAATACGACTCACTATAGGGAGA] and the primer sequences in Table 2.

'Recently, a briefcase was turned in that contained $100,000 worth of bonds payable to the bearer," Mr. Dolan said.

The tension in that contained space pushes the narrative faster than any hyperdrive.

It is decorated in pretty pinks and blues, with pale wood built-ins that contain considerable storage space.

If is a convex body in that contains the origin in its interior, then (3.1).

Each result also has a profile page for that person, similar to LinkedIn, that contains their work experience, education, contact information, and bio.

Theorem A. If is a convex body in that contains the origin in its interior, and, then (1.5).

If are convex bodies in that contain the origin in their interior, then the following equalities are equivalent: (3.9).

If is a convex body in that contains the origin in its interior, and, then for, (3.25).

Theorem B. If is a convex body in that contains the origin in its interior, and, then (1.6).

If is a convex body in that contains the origin in its interior, let, then for, (3.7).