Sentence examples for in shine from inspiring English sources

"in shine" is not a correct part of a sentence in written English.
It does not make sense grammatically. It is possible to use "shine" in a sentence as a noun or verb, but it would need to be used in a different sentence structure. For example: - The sun's shine was blinding. - The diamond's shine caught everyone's eye. - She loves to see her car shine after a good wash.

Exact(55)

Also you could purchase a deep conditioner, or use a home remedy, to lock in shine.

In SHINE, VHWs are dually supervised; (1) by Ministry of Health and Child Care nurses in carrying out their regular duties, and (2) by SHINE research staff in carrying out the additional tasks required by the trial.

"I was getting ready to come in," Shine said.

In Shine, she, like silent Rosa, has truly found her voice.

There are scenes in "Shine" which undermine its theraputic, New Agey message.

[2] The other is Geoffrey Rush; they played David Helfgott young and old in Shine.

"Then you're playing in shine, frills, low-cut tops," Preysman said.

Show more...

Similar(4)

These are commonly found in conditioner and leave-in shine products.

VHWs were trained in SHINE-specific modules in separate groups according to the randomized allocation of the cluster in which they live and work.

Sequences of consecutive guanines are sometimes interrupted by adenines, as shown in UGGGGGGAGGGAGGGAGGGA of the 3'-untranslated region of chicken elastin mRNA (6), and GGAGG in Shine-Dalgarno sequence (7).

She may have left the family business, but the family business has not left her, with BSkyB an 8% shareholder in Shine Group, along with Sony Pictures Television International and venture capitalist 3i.

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: