Sentence examples for in shine from inspiring English sources

Also you could purchase a deep conditioner, or use a home remedy, to lock in shine.

In SHINE, VHWs are dually supervised; (1) by Ministry of Health and Child Care nurses in carrying out their regular duties, and (2) by SHINE research staff in carrying out the additional tasks required by the trial.

"I was getting ready to come in," Shine said.

In Shine, she, like silent Rosa, has truly found her voice.

There are scenes in "Shine" which undermine its theraputic, New Agey message.

[2] The other is Geoffrey Rush; they played David Helfgott young and old in Shine.

"Then you're playing in shine, frills, low-cut tops," Preysman said.

These are commonly found in conditioner and leave-in shine products.

VHWs were trained in SHINE-specific modules in separate groups according to the randomized allocation of the cluster in which they live and work.

Sequences of consecutive guanines are sometimes interrupted by adenines, as shown in UGGGGGGAGGGAGGGAGGGA of the 3'-untranslated region of chicken elastin mRNA (6), and GGAGG in Shine-Dalgarno sequence (7).

She may have left the family business, but the family business has not left her, with BSkyB an 8% shareholder in Shine Group, along with Sony Pictures Television International and venture capitalist 3i.