Sentence examples for in revs from inspiring English sources
I have absolutely no problem with other people immersing themselves in revs, speed and petrol stink.
Instead, release the clutch progressively, and counter the drop in revs with a slight increase on the throttle.
Primers used for the outer PCR were CMV-For (5'-AACCCACTGCTTACTGGCTTATCG-3') and In-Rev (5'- CGGCGCGGTTTCGGCG -3'), for the inner PCR T7-For (5'- AATACGACTCACTATAGGG -3') and Deletion-Rev (5'- CCCCAACAAAGCCACTCCAAAA -3').
Experiments are underway in our laboratory to better characterize the regulation of IN activity, especially by following the IN-Rev interaction in virus-infected cells.
"We don't believe in revving up our patients.
There's been a double-digit increase in "rev par" in 2010 -- the revenue per available room.
P. F. Henderson: Occupying office, after turning up I've often worked - thus? (in (rev).
It's the perfect face for Adam Smallbone, the vicar he plays in Rev, last year's surprise hit TV show.
Tom Hollander, as we know from from his TV performances in Rev and The Night Manager, is a highly versatile actor.
V β and V σ are the volumes of β- and σ-phases in REV, respectively.
