Your English writing platform
Free sign upSuggestions(1)
Exact(1)
Enzyme activities were expressed in katals both in reference to the weight of fresh tissue and its protein content.
Similar(58)
Estimates of odds ratios in reference to the weight-stable group were presented along with 95% CIs.
Metabolic rates were calculated from the differences between the input and output and the total flow rates and were analysed in reference to the wet weights of the livers.
To estimate differences in quantitative variables between the two groups, such as predelivery insulin dose, maternal weight gain in reference to the first visit, and newborn glycemia, the Mann–Whitney test was used.
Thus, while both breast cancer and control group were matched in reference to body weight, it does not measure obesity making it a possible confounding variable in this study.
We used Cox proportional hazards models to estimate incidence rate ratios (IRRs) and 95% CI for categories of birth weight (very low birth weight [<1,500 g], low birth weight [1,500 2,499 g], and high birth weight [≥4,000 g]) in reference to normal birth weight (2,500 3,999 g).
The primer sequences were: allele C, forward: 5'ATCCGCTGCACAAGTGACCC; allele G, forward: 5'ATCCGCTGCACAAGTGACCG; constant reverse: 5'CCCTACTAAATCTGGACCTCATC. The presence/absence of allele-specific amplicons was visualized by electrophoresis on 2% agarose gel and ethidium bromide fluorescence in reference to a molecular weight marker.
The HR for each category of this variable was estimated in reference to women with birth weight in the medium class, silhouette 2 at 8 years, and baseline BMI <25 kg/m.
The shout about town to-day is: "How would you like to be the President?" This is in reference to President Taft, who weights 322lb.
Growth performance of the plant in reference to plant height, tillers, fresh weight, and number of leaves during the soil experiment is depicted in Figure 4(b).
Similar chromatographic resolution of proteins from plant cell extracts suggested that plants differ from mammalian cells in that they contain two different but related proteins termed plant eIF4E and eIF iso 4E, or p26 and p28 (in reference to their apparent molecular weights as judged by SDS-PAGE) [ 22, 23].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com