Sentence examples similar to in every part of the transcript from inspiring English sources

In another part of the transcript, he explained why.

The fusion nature of this clone was confirmed by RT-PCR on cell line IMR-32 using a primer in the first part of the transcript on 2p13.3 and a primer in the other part of the transcript on 2p24.3.

Examination of the fusion transcript was done with a forward primer in the first part of the transcript (F 5'CandCTGTTCTGaCGGTTCCA3') and a reverse primer in the other part (R 5'CAAAGTAGAATATAGTTGTCCAAAACACAA3'CAAAGTAGAATATAGTTGTCCAAAACACAA3

To read part of the transcript.

Allen gave evidence in secret, with parts of the transcript later released.

· Read the first part of the transcript here.

The main part of the transcript from the unclassified section of the tribunal was released yesterday.

To see an annotation, click or tap the highlighted part of the transcript.

Boxes with a red 'X' indicate exons that are not part of the transcript.

The advantage is that your email -- which is part of the transcript of your life -- is available for you to review any time in the future.

Notes that framed the interview were misinterpreted as part of the transcript.