Sentence examples for in addition to predicted from inspiring English sources

When searching for ER binding sites, in addition to predicted TFBSs as described above, information from TRANSFAC [41] and pattern search implementation using 3 consensus sequences, TCGACGCTTTCAAGGTCATATCCG, TCGACAAAGTCAGGTCACAGTGACCTGATCAAG and GGTCANNNTGACC, where 'N' represents an arbitrary nucleotide, [9], [42] were also utilized.

In addition to predicted survival, a stratified-survival visualization using Kaplan Meier plots was also performed.

Gene annotations consisted of 16426 genes from the Ensembl database Release 66 [ 50], which included a majority of RefSeq genes in addition to predicted genes and miRNAs.

In addition to predicted differences in sub-cellular localization, the three proteins have different patterns of expression as determined by in-silico analysis and confirmed by RT-PCR.

In addition to predicted MYB targets we also selected several control genes which were constituently expressed across the NCI-60 cell lines, regardless of the MYB expression levels.

However, given increased maritime transportation and eutrophication in addition to predicted increase in temperature and decrease in salinity, these genetically impoverished low-salinity populations may be at considerable risk.

In this scenario, the benefit of predictions could be even greater if, in addition to predicting the number of users interested in a web content, one could also predict which users will trigger the requests.

In addition to predicting the winners and losers, our model also projects a margin of victory -- a point spread -- for each game.

This is in addition to predicting condensation on cooling coils.

These methods consider social contacts in addition to predicting future movements.

In addition to predicting when a customer is set to arrive, the app also gets to know users based on their common orders.