Sentence examples for in a single end from inspiring English sources

Earlier this week, Muirhead's rink set a new Olympic record by notching a seven in the fourth against the United States (another 12-3 victhey), the most points scored by either a men's or women's team in a single end.

With that effort in the seventh, Team Muirhead once again got their names in the record books, equalling the highest number of points stolen in a single end of an Olympic fixture since curling, in its current format, was introduced to the Games programme in 1998 - matching a feat that Canada's men are the only other team to have achieved.

They never recovered from the fourth end, when Russia scored with a Paralympic record seven of their eight stones in a single end to go 11-3 ahead.

Thus, there were two sequencing reads for one fragment in a paired end run and one sequencing read for one fragment in a single end run.

Due to the high frequency of cleavage sites in the genome, TM3C is highly likely to capture ligations between DNA fragments from two different loci in a single end of a read.

Libraries were then pooled and run for 51 cycles in a single end sequencing reaction on a single lane of an Illumina Genome Analyzer II (Tufts University) using the custom sequencing primer pSAM3 (5′ ACACTCTTTGACCGGGGACTTATCATCCAACCTGTTA 3′) and the standard Illumina index sequencing primer.

The next generation sequencing generated a shorter read length that demonstrated the important features of the LM-PCR product in either a single end read or in the reads derived from each of the paired ends.

One strain (CP4) was sequenced in a single-end (2 lanes) and a paired-end (1 lane) run with the Illumina/Solexa Genome Analyzer, and the reads were assembled de novo with Velvet [23].

For most RED-seq libraries (GFP, Oct4, Ep400 and Hira KD), we added one further modification in which the sequence of the biotinylated adapters and the second, non-biotinylated, adapters were modified such that after PCR amplification of the libraries, only the end that was ligated to the biotinylated adapter would be sequenced in a single-end sequencing run (Additional file 3).

Brabants explains the difference: kayakers sit in a closed cockpit, use a rudder and a double-ended paddle; canoeists race kneeling on one knee in an open cockpit with a single ended paddle and they are rudderless.

In fact, if θ ∈ Θ n is isolated, then the ray R = {reiθ: r ≥ γ-n-1} is contained in a single prime end of Ω.