Your English writing platform
Free sign upExact(1)
The 1 × reaction mix contained Uracil-N-Glycosylase (UNG) to prevent carry-over contamination between PCR reactions and the DNA was added in a separate template addition area.
Similar(59)
Each different ring element, size or bond type will demand a separate template, greatly increasing the number of extracted templates.
A separate template file was derived and visually validated specifically for each cell line.
To confirm the absence of genomic-DNA contamination, a pool of all eight RNA samples (see above) was used as template in a separate reaction as described above except omitting the reverse-transcriptase.
The second template is in a separate mode (test-atoms-have-3d-coordinates) and tests that an atomArray is present and that all the child atoms of this have 3D coordinates.
A separate data/label template geared specifically toward collecting California rare plants is provided in collaboration between the California Plant Phylodiversity Project (CPPP) and the CNPS Rare Plant Treasure Hunt.
Meanwhile, the Actin cDNA fragment was amplified, as a control, in a separate reaction with the same RNA as template using primer Act1 (5'AGGGCTGTTTTCCCTAGTATCGTGG) and Act2 (5'GATGGCATGAGGAGGGGCAT).
In a variant of the standard PCR reaction termed bridging, or jumping, PCR the primer-bound sequences are originally on separate template molecules.
As an internal control of cDNA templates, the housekeeping gene GAPDH (glyceraldehyde phosphodehydrogenase) was assessed with each cDNA in a separate PCR reaction.
We also saw an opportunity here – we have a separate remote templates location which allows us to deploy updated templates very quickly to all app users without the need to release an updated version of the app itself.
#boycotteltonjohn," he stated in a separate post.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com