Sentence examples for implemented according to a from inspiring English sources

Policy guidelines that would have prevented spying on ordinary citizens not suspected of criminal wrongdoing sat in the desk of the captain who was head of the police intelligence bureau, never implemented, according to a deposition by Deputy Chief David Abrams.

And so far only 66.0% of the total cut has been implemented, according to a Reuters survey: key OPEC member Saudi Arabia has tightened its taps accordingly while Ecuador did not reduce production at all.

To carry out the computational resolution of the structural problem, the Finite Element Method (FEM) will be implemented according to a Total Lagrangian Formulation (TLF), by means of the Direct Core Congruential Formulation (DCCF).

Kentucky also saw declines in the rates of people skipping needed care, visiting emergency rooms for care, and struggling to pay medical bills in the years after the law was implemented, according to a survey conducted by the Foundation for a Healthy Kentucky.

Real time polymerase chain reaction (PCR) diagnostics for S. suis serotype 2 with cps2J as gene target (primers and probe: forward GGTTACTTGCTACTTTTGATGGAAATT, reverse CGCACCTCTTTTATCTCTTCCAA, probe FAM-TCAAGAATCTGAGCTGCAAAAGTGTCAAATTGA-TAMRA) were implemented according to a previously described method [2].

Postoperative care was implemented according to a standardized regimen.

This catalogue has been implemented according to an IVOA data model, and can be accessed through VO-compatible applications.

Time discretization of convolution integral has been implemented according to an existing and a newly proposed procedure, which differ in the numerical integration methods.

If implemented according to an adaptive ecosystem management framework, human-facilitated efforts to restore ecological function can provide needed support when natural regeneration seems insufficient to restore and sustain the health, productivity, and biodiversity of the system (Griscom and Ashton 2011).

None of these improvements was designed and implemented according to an explicit plan in response to a documented gap in chronic disease care.

An IVGTT-derived measure of insulin sensitivity, Si, (IVGTT-Si) was provided by minimal model analysis of IVGTT glucose and insulin concentrations, implemented according to an optimised algorithm, as described previously [ 16].