Sentence examples for implement according to a from inspiring English sources

A clampdown on UNITA's diamond trade would be the most effective but impossible to implement, according to a diamond dealer in Luanda: "We all know that most Angolan diamonds come from UNITA, but you can never stop dealers buying them".

Western Australian premier Colin Barnett's threat to "disengage" the state from the broader Australian economy if the GST debate is not resolved in WA's favour would be almost impossible to implement, according to an expert.

Policy guidelines that would have prevented spying on ordinary citizens not suspected of criminal wrongdoing sat in the desk of the captain who was head of the police intelligence bureau, never implemented, according to a deposition by Deputy Chief David Abrams.

And so far only 66.0% of the total cut has been implemented, according to a Reuters survey: key OPEC member Saudi Arabia has tightened its taps accordingly while Ecuador did not reduce production at all.

To carry out the computational resolution of the structural problem, the Finite Element Method (FEM) will be implemented according to a Total Lagrangian Formulation (TLF), by means of the Direct Core Congruential Formulation (DCCF).

Kentucky also saw declines in the rates of people skipping needed care, visiting emergency rooms for care, and struggling to pay medical bills in the years after the law was implemented, according to a survey conducted by the Foundation for a Healthy Kentucky.

Real time polymerase chain reaction (PCR) diagnostics for S. suis serotype 2 with cps2J as gene target (primers and probe: forward GGTTACTTGCTACTTTTGATGGAAATT, reverse CGCACCTCTTTTATCTCTTCCAA, probe FAM-TCAAGAATCTGAGCTGCAAAAGTGTCAAATTGA-TAMRA) were implemented according to a previously described method [2].

Postoperative care was implemented according to a standardized regimen.

Management interventions are often described as experimental "treatments" that are implemented according to a management design, but the resulting learning is seen as a means to an end namely, effective management and not as an end in itself (Walters 1986).

To compare the PSMA functional inhibition of 9 to its Mnv analog 3 and a positive control (DCIBzL), a fluorescence-based glutamate-hydrolysis inhibition assay was implemented according to a published procedure (Amplex red assay).

In the NONMEM example (Model 1), the numerical search for the minimum of the -2LL is implemented according to a modified algorithm by [ 24] which is a derivate-free quasi-Newton type minimization algorithm.