Suggestions(1)
Exact(1)
Subjects were shown identical DXA results and associated fracture risk (21% or high risk) using the four illustrations discussed above.
Similar(59)
The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.
As discussed above, this is now quantified.
(discussed above).
As an illustration, we apply the algorithms discussed above to solve the homogeneous and inhomogeneous pseudoscalar-meson BSEs and compare their efficiency in terms of the number of matrix vector multiplications needed to achieve a specified accuracy.
However, the local concentration of galactosyl groups in a nanodomain of GalCer is extremely high compared with the maximal concentration of free galactose in biological fluids (another illustration of the reduction-in-dimensionality concept discussed above).
*Gay Jesus, as discussed above.
These were discussed above.
Heart failure is discussed above.
As discussed above, Juroraphidiidae fam.
(Background concentrations were discussed above).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com