Sentence examples for illustrate the shared from inspiring English sources

Exact(2)

His meaningful encounters with people on his journey illustrate the shared culture and heritage of South Asia, as well as the hateful suspicions and intolerance that permeate throughout the India-Pakistan frontier.

This example will be used to illustrate the shared similar segment determination using Equation 5: uprobe = new usm('aaagctatctgaaaggtcaa',ubase.abc) > usm As ubase, uprobe is an instance of the usm object but its creation took an additional input argument, the alphabet identified for ubase.

Similar(58)

More humbling yet, there seem to be only some 300 human genes that have no counterpart in the mouse genome, illustrating the shared genetic heritage of different species that all evolved from common single-celled ancestors eons ago.

Nonserious AE-reporting variation was not explained by adjustment.An integrated collection of end points and serious AEs is feasible in a multinational trial and illustrates the shared characteristics of events.

Figure 4 illustrated the shared GO terms and P values in subcategory "cellular component".

(a) illustrates how geometry is shared among multiple proxy actors, while (b) illustrates the sharing of composable animation sequences.

The maps, which illustrate the share of each state's population with student debt and the percentage of each state's borrowers now delinquent on their payments, reveal an apparently complicated relationship between the two.

Figure 2 illustrates the share of fuels and manufactures exports as a percentage of merchandise exports of Colombia from 1962 2011.

The move will leave the American government owning one-third of the financial institution (now trading at about $3.50 per share!).Now, it is easy to blow out of proportion the extent to which the American government is involving itself in private business; Conor Clarke recently and helpfully illustrated the share of corporate America controlled by the government in this chart.

Figure 1 illustrates the share of global chocolate market in 2011 by region, as evidenced in the literature.

Figure 2 illustrates the share of expenditures devoted to HIV spending and HIV DALYs by region.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: