Your English writing platform
Discover LudwigExact(3)
Performance of this assay was evaluated in combination with two different internal amplification controls (IAC), a competitive one specific for the assay and a universal IAC based on plasmid pUC19.
At the center of the network was a listserv group email list of more than 100 prominent individuals and science research bodies run out of the Immunization Action Coalition (IAC) based in St Paul, Minnesota.
We calculated the inter-array correlation (IAC) based on Pearson's correlation coefficient for tumor and control samples, respectively.
Similar(57)
The new files suggest that Mossack Fonseca worked hard to prove that IAC was based offshore and therefore outside the reach of the New York courts.
A diagnosis of IAC was based on the HISORt (HIstology, Serology and Imaging, Other organ involvement and Response to therapy) criteria (Chari, 2007).
The IAC, to be based at the Netherlands Academy in Amsterdam, will produce peer-reviewed reports by scientists who serve without compensation, and who will communicate mainly via e-mail.
The accredited method was based on IAC clean-up with ultra-HPLC and fluorescence detection.
The IAC qPCR was developed based on a 105 base template derived from the jellyfish aequorin gene which has a sequence of 5'- GCCTGGTGCAAAAATTGCTTATCAAATTGAACGGTCAATTGGAAGTGGCGGAAGAACAGCTATTGCAAACGC CATCGCACAATACCATAAACACACTTGTCTTAG-3' [ 24].
IAC-owned Vimeo is based in New York City, and reaches more than 85 million viewers per month, according to comScore data.
Lowry and the rest of the team will stay intact with the move to IAC, and will keep UrbanSpoon based in Seattle.
None of the PSC patients would be classified as having IAC instead of PSC solely based on sIgG4 and corticosteroid treatment would only be started in patients with a sIgG4 above 4× ULN or patients with histological signs of IgG4-RD.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com