Sentence examples for i was underlining from inspiring English sources

I was underlining like mad, dog earring pages left and right, and calling my husband every five seconds to read a passage.

The White House had sent a copy of the president's remarks to reporters and I was underlining key parts of it as he spoke.

And I'm underlining the if and when".

When my character visits Fusun's middle-class family for eight years, looking at TV every night, I am underlining, tongue in cheek, the actual experience of 90percentt of humanity.

When my character visits Fusun's middle class family for eight years looking at TV every night I am underlining, tongue in cheek, the actual experience of 90percentt of humanity.

Tandem versions were generated by digesting EcoRI/Xba and inserting an additional linker (AATTTTGTCTTCCTGATCGGCGCCGCAGGAATACTCTTCGTATCTAGAGTGAATTCCTAA, newly situated restriction sites Xba-EcoRI are underlined).

Linker constructs were obtained by excising the Epac1 ΔDEP, CD) domain using EcoRV/NheI and replacing it with a linker (GATATCCTTTTGCTAGC, restriction sites EcoRV-NheI are underlined), yielding a 13aa linker (SGLRSRYPFASEL) between the two fluorophores.

The Ala135 codon substituting the His codon of wild-type SP I is underlined.

FP1: 5′ - ATA T GG ATC CTA CAC AAT GTC TGC CGC ACC CAC CAC CAC CGT - 3′ (BamHI is underlined), RP1: 5′ - ATA T AA GCT TCT AGT TGG TGA CAA ATT TTC TGG GAG AA - 3′ (HindIII is underlined) and FP2: 5′-ATA T GG ATC CTA CAC AAT GTC TGC CAC ACC CAC CGC CGC CGT - 3′ (BamHI is underlined), RP2: 5′ - ATA T AA GCT TCT AGT TGG TGA CAA ATT TTC TGG GAG AGG - 3′ (HindIII is underlined).

First, we introduced Xcm I site between Hind III and Kpn I at pSK by two self-complementary oligonucleotides 5'-AGCTTU CCAUTATGATTTTU TGGUGGTAC and 5'-AU GGTUATACTAAAAU ACCUC where Xcm I recognition site was underlined.

"I think he's underlining the point that I've been making all along," Mr. Miller said.